医学SCI 论文经典句子汇编

Title
要求简练，精确
Compassionate use of bevacizumab (Avastin) in children and young adults with
refractory or recurrent solid tumors.
Bevacizumab-induced transient remodeling of the vasculature in neuroblastoma
xenografts results in improved delivery and efficacy of systemically administered
chemotherapy.
Proteomics Approaches to the Systems Biology of Cardiovascular Diseases
Pre- and post-natal treatment of hemophagocytic lymphohistiocytosis.
Lack of early bevacizumab-related skeletal radiographic changes in children with
neuroblastoma.
Interleukin-4 activates androgen receptor through CBP/p300
Trisomy 8 in an allogeneic stem cell transplant recipient representative of a
donor-derived constitutional abnormality.
Disruption of diacylglycerol metabolism impairs the induction of T cell anergy
T cell anergy is reversed by active Ras and is regulated by diacylglycerol kinase-
High-dose conformal RT improves tumor control in patients with prostate cancer
Vitamin D concentration does not affect the risk of prostate cancer
Liver resection with salvage transplantation for hepatocellular carcinoma
The impact of histopathologic diagnosis on the proper management of testis neoplasms
Prostate stem cell antigen is associated with diffuse-type gastric cancer
Multiple myeloma: high-risk immunophenotypes identified
Increased c-kit expression predicts poor outcome in acute myeloid leukemia
Global Analysis of the Meiotic Crossover Landscape
Serum Response Factor Is Required for Sprouting Angiogenesis and Vascular Integrity
Integrin Trafficking Regulated by Rab21 Is Necessary for Cytokinesis
Reduced Translocation of Nascent Prion Protein During ER Stress Contributes to
Neurodegeneration
Effects of oral niacin on endothelial dysfunction in patients with coronary artery disease:
Results of the randomized, double-blind, placebo-controlled INEF study.
Global experiences with vardenafil in men with erectile dysfunction and underlying
conditions.
2
Noninvasive cardiac imaging: implications for risk assessment in adolescents and young
adults.
Transforming growth factor beta1 T29C gene polymorphism and hypertension:
Relationship with cardiovascular and renal damage.
A comparison of hormone therapies on the urinary excretion of prostacyclin and
thromboxane A2.
Repair of an infected aortic aneurysm using an aortic allograft and a venous autograft:
Report of a case.
Circulating Leptin and Stress-induced Cardiovascular Activity in Humans.
Effects of aspirin dose on ischaemic events and bleeding after percutaneous coronary
intervention: insights from the PCI-CURE study.
Long-term cardiovascular outcomes following ischemic heart disease in patients with and
without peripheral vascular disease.
Reduced renal function and sleep-disordered breathing in community-dwelling elderly
men.
Intracoronary pharmacotherapy in the management of coronary microvascular
dysfunction.
Inhibition of platelet aggregation by combined therapy with aspirin and cilostazol after
off-pump coronary artery bypass surgery.
Inhibition of CCR2 Ameliorates Insulin Resistance and Hepatic Steatosis in db/db Mice
Abstract 要求简洁，连贯
The acquisition of metastatic ability by tumor cells is considered a late event in the
evolution of malignant tumors. We report that untransformed mouse mammary cells that
have been engineered to express the inducible oncogenic transgenes MYC and KrasD12, or
polyoma middle T, and introduced into the systemic circulation of a mouse can bypass
transformation at the primary site and develop into metastatic pulmonary lesions upon
immediate or delayed oncogene induction. Therefore, previously untransformed
mammary cells may establish residence in the lung once they have entered the
bloodstream and may assume malignant growth upon oncogene activation. Mammary
cells lacking oncogenic transgenes displayed a similar capacity for long-term residence in
the lungs but did not form ectopic tumors.
Almost two decades after CFTR was identified as the gene responsible for cystic fibrosis
(CF), we still lack answers to many questions about the pathogenesis of the disease, and it
remains incurable. Mice with a disrupted CFTR gene have greatly facilitated CF studies,
but the mutant mice do not develop the characteristic manifestations of human CF,
including abnormalities of the pancreas, lung, intestine, liver, and other organs. Because
pigs share many anatomical and physiological features with humans, we generated pigs
with a targeted disruption of both CFTR alleles. Newborn pigs lacking CFTR exhibited
defective chloride transport and developed meconium ileus, exocrine pancreatic
destruction, and focal biliary cirrhosis, replicating abnormalities seen in newborn humans
3
with CF. The pig model may provide opportunities to address persistent questions about
CF pathogenesis and accelerate discovery of strategies for prevention and treatment.
Variable lymphocyte receptors (VLRs) rather than antibodies play the primary role in
recognition of antigens in the adaptive immune system of jawless vertebrates.
Combinatorial assembly of leucine-rich repeat (LRR) gene segments achieves the
required repertoire for antigen recognition. We have determined a crystal structure for a
VLR-antigen complex, VLR RBC36 in complex with the H-antigen trisaccharide from
human blood type O erythrocytes, at 1.67 angstrom resolution. RBC36 binds the
H-trisaccharide on the concave surface of the LRR modules of the solenoid structure
where three key hydrophilic residues, multiple van der Waals interactions, and the highly
variable insert of the carboxyl-terminal LRR module determine antigen recognition and
specificity. The concave surface assembled from the most highly variable regions of the
LRRs, along with diversity in the sequence and length of the highly variable insert, can
account for the recognition of diverse antigens by VLRs.
A 51-year-old man with a diagnosis of myelodysplasia and non-Hodgkin's lymphoma
underwent an unmatched allogenic bone marrow transplantation and was treated
posttransplant with chronic immunosuppressive medication. Eight months following
transplantation, he presented with progressive dysarthria, cognitive and visual decline.
Evaluation included brain magnetic resonance (MR) imaging demonstrating multifocal
areas of increased T2 and FLAIR (fluid attenuated inversion recovery) signals involving
the left frontal, parietal, and occipital lobes. The MR lesions demonstrated diffuse
increased signal on DWI (diffusion-weighted images) and normal to low signal on ADC
(apparent diffusion coefficients). Contrast-enhanced T1 images were unremarkable.
Lumbar puncture revealed a mild elevation in cerebrospinal fluid (CSF) protein. CSF
PCR assay for viral DNA fragments were negative on two occasions. Serum serology for
HIV was negative as well. A brain biopsy was subsequently performed. The clinical and
neuroimaging differential diagnoses as well as neuropathologic correlation are presented.
In vitro-generated mesenchymal stem cells (MSCs) initially attracted interest for their
ability to undergo differentiation toward cells of different lineages.
These results suggested that
However, there are still obstacles in
The major challenge for successful drug development is identifying delivery strategies
that can be translated to the clinic.
This review will discuss progress in developing and testing small RNAi-based drugs and
potential obstacles.
This review highlights what
In addition, there are indications that
Proper consideration of all of these issues will be necessary in
These studies provide
This paper presents the potential applications and the hurdles facing anti-HCV siRNA
drugs.
The present review provides insight into the feasible therapeutic strategies of siRNA
technology, and its potential for silencing genes associated with HCV disease.
4
A basic problem in the design of xx is presented by the choice of a xx rate for the
measurement of experimental variables.
This paper examines a new measure of xx in xx based on fuzzy mathematics which
overcomes the difficulties found in other xx measures.
This paper describes a system for the analysis of the xx.
The method involves the construction of xx from fuzzy relations.
The procedure is useful in analyzing how groups reach a decision.
The technique used is to employ a newly developed and versatile xx algorithms.
The usefulness of xx is also considered.
A brief methodology used in xx is discussed.
The analysis is useful in xx and xx problem.
A model is developed for a xx analysis using fuzzy matrices.
Algorithms to combine these estimates and produce a xx are presented and justified.
The use of the method is discussed and an example is given.
Results of an experimental applications of this xx analysis procedure are given to
illustrate the proposed technique.
This paper analyses problems in
This paper outlines the functions carried out by ...
This paper includes an illustration of the ...
This paper provides an overview and information useful for approaching
Emphasis is placed on the construction of a criterion function by which the xx in
achieving a hierarchical system of objectives are evaluated.
The main emphasis is placed on the problem of xx
Our proposed model is verified through experimental study.
The experimental results reveal interesting examples of fuzzy phases of : xx,xx
The compatibility of a project in terms of cost, and xx are likewise represented by
linguistic variables.
A didactic example is included to illustrate the computational procedure
Introduction 引证核心文献，提出假设，指出文章的核心观点
Beginning
Over the course of the past 30 years, .. has emerged form intuitive
We evaluated 508 participants who
Acute kidney injury (AKI) is associated with an increased incidence of respiratory failure
requiring mechanical ventilation, which greatly increases mortality
The cause of respiratory failure in patients with AKI is incompletely understood
However, lung injury also occurs after ischemia–reperfusion injury of other organs such
as the liver, gut, and hind limb
We have demonstrated previously that
Given this background, we hypothesized that
we demonstrate that
Technological revolutions have recently hit the industrial world
The advent of ... systems for has had a significant impact on the
5
The development of ... is explored
The concept of xx was investigated quite intensively in recent years
There has been a turning point in ... methodology in accordance with the advent of ...
A major concern in ... today is to continue to improve...
It has become increasingly clear that
In this paper, we focus on the need for
This paper proceeds as follow.
The structure of the paper is as follows.
Our study
In this paper, we shall first briefly introduce…
To begin with we will provide a brief background on the
This will be followed by a description of the xx of the problem and a detailed
presentation of how the required membership functions are defined.
Details on xx and xx are discussed in later sections.
Polyphenolic compounds are vasodilators and help to lower the risk of cardiovascular
diseases.
Taken together, our novel findings suggest that the EDR induced by the strawberry
extract was mediated by activation of the PI3 kinase/Akt signaling pathway, resulting in
phosphorylation of eNOS.
Objective / Goal / Purpose
The purpose of the inference engine can be outlined as follows:
The ultimate goal of the xx system is to allow the non;experts to utilize the existing
knowledge in the area of manual handling of loads, and to provide intelligent,
computer;aided instruction for xxx.
The paper concerns the development of a xx
The scope of this research lies in
The main theme of the paper is the application of rule;based decision making.
These objectives are to be met with such thoroughness and confidence as to permit ...
The objectives of the ... operations study are as follows:
The primary purpose/consideration/objective of
The ultimate goal of this concept is to provide
The main objective of such a ... system is to
The aim of this paper is to provide methods to construct such probability distribution.
In order to achieve these objectives, an xx must meet the following requirements:
In order to take advantage of their similarity
more research is still required before final goal of ... can be completed
In this trial, the objective is to generate...
for the sake of concentrating on ... research issues
A major goal of this report is to extend the utilization of a recently developed procedure
for the xx.
For an illustrative purpose, four well;known OR problems are studied in presence of
fuzzy data: xx.
6
This illustration points out the need to specify
Recent studies have further defined the role of SBP-2 in promoting UGA read-through,
This concept has been further validated with the discovery of patients with impaired
deiodinase activity due to a mutation in SBP-2
The ultimate goal is both descriptive and prescriptive.
A wealth of information is to be found in the statistics literature, for example, regarding
xx
This review will focus on the most recent progress achieved in this field, particularly the
cellular and molecular aspects of local control of thyroid hormone signaling provided by
deiodinases.
A considerable amount of research has been done .. during the last decade
A great number of studies report on the treatment of uncertainties associated with xx.
There is considerable amount of literature on planning
However, these studies do not provide much attention to undertainty in xx.
Since then, the subject has been extensively explored and it is still under investigation as
well in methodological aspects as in concrete applications.
Many research studies have been carried out on this topic.
Problem of xx draw recently more and more attention of system analysis.
Attempts to resolve this dilemma have resulted in the development of
Many complex processes unfortunately, do not yield to this design procedure and have,
therefore, not yet been automated.
Most of the methods developed so far are deterministic and /or probabilistic in nature.
The central issue in all these studies is to
The problem of xx has been studied by other investigators, however, these studies have
been based upon classical statistical approaches.
Applied ... techniques to
Characterized the ... system as
Developed an algorithm to
Developed a system called ... which
Uses an iterative algorithm to deduce
Emphasized the need to
Identifies six key issues surrounding high technology
A comprehensive study of the .. has been undertaken
Much work has been reported recently in these filed
Proposed
Presented
State that
Point out that the problem of
Described
Illustrated
Indicated
Has shown / showed
Address
7
Highlights
A study on ...was done / developed by []
Previous work, such as [] and [], deal only with
The approach taken by [] is
The system developed by [] consists
A paper relevant to this research was published by []
[]'s model requires consideration of ..
[]' model draws attention to evolution in human development
[]'s model focuses on...
Little research has been conducted in applying ... to
The published information that is relevant to this research...
This study further shows that
Their work is based on the principle of
More history of ... can be found in xx et al. [1979].
Studies have been completed to established
The ...studies indicated that
Though application of xx in the filed of xx has proliferated in recent years, effort in
analyzing xx, especially xx, is lacking.
提出Problem / Issue / Question 或假设
Unfortunately, real-world engineering problems such as manufacturing planning do not
fit well with this narrowly defined model. They tend to span broad activities and require
consideration of multiple aspects.
Remedy / solve / alleviate these problems
It has recently been reported that
... is a difficult problem, yet to be adequately resolved
Two major problems have yet to be addressed
An unanswered question
This problem in essence involves using x to obtain a solution.
An additional research issue to be tackled is ....
Some important issues in developing a ... system are discussed
The three prime issues can be summarized:
The situation leads to the problem of how to determine the ...
There have been many attempts to
It is expected to be serious barrier to
It offers a simple solution in a limited domain for a complex problem.
There are several ways to get around this problem.
As difficult as it seems to be, xx is by no means new.
The problem is to recognize xx from a design representation.
A xx problem can trace its roots to xx.
xx [1987] used a heuristic approach to simplify the complexity of the problem.
Several problems are associated with them.
Although some progress has been made in this area, at least two major obstacles must be
overcome before a fully automated system can be realized.
Most problems in practice are complicated
More problem surface here.
Hamper effort toward a xx system
In order to overcome the limitations due to incomplete and imprecise xx knowledge, a xx
program has been developed, which bases its knowledge upon the statistical analysis of a
sample population of xx
The above difficulties are real challenges faced by researchers attempting to develop
This type of mapping raises no controversy to the issue of membership function
determination.
However, attempts to quantify the xx have met both theoretical and empirical problems.
It has become apparent that in order to apply this new methodological framework to
real;world problems and data, we have to pay attention to the problems of xx and xx.
MATERIALS AND METHODS
Materials
Chemicals were purchased from Sigma (St Louis, MO), if not stated otherwise.
Experiments were conducted in accordance with the NIH Guidelines for the Care and Use
of Laboratory Animals.
CsA, EGF, PD98059, U0126, AG1478, Wortmannin, and LY294002 were from
Calbiochem (San Diego, CA, USA). Anti-ERK1/2 and anti-Ras were from Transduction
Laboratories (Franklin Lakes, NJ, USA). Anti-phospho Raf-1 (Ser259), anti-phospho
Raf-1 (Ser338), anti-phospho PKB/Akt (Ser473), anti-PKB, anti-phospho EGFR (Tyr1068),
anti-phospho ERK1/2 (Thr202/Tyr204), anti-PI3K 110 , anti-p53, and anti-phospho
MEK1/2 (Ser217/221) were from Cell Signalling (Danvers, MA, USA). Anti-MEK and
anti-Raf-1 (C12) were from Santa Cruz (Santa cruz, CA, USA). Apigenin and all other
reagents were from Sigma (Saint Louis, MO, USA).
Animal
Eight- to ten-week-old male C57BL/6 mice (wild-type) and IL-6-deficient mice
backcrossed over eight generations on a C57BL/6 background were used
Mice were maintained on a standard diet and water was made freely available.
All experiments were conducted with adherence to the NIH Guide for the Care and Use
of Laboratory Animals.
The animal protocol was approved by the Animal Care and Use Committee of the
University of Colorado
Three surgical procedures were performed as described previously:5 (1) sham operation,
(2) ischemic AKI, and (3) bilateral nephrectomy.
The abdomen was closed in one layer.
Sham surgery consisted of the same procedure except that clamps were not applied.
9
For bilateral nephrectomy, renal pedicles were tied off with suture and then cut distally.
The ureters were pinched off with forceps and the kidneys removed.
Serum was collected as described previously.5 Blood urea nitrogen and creatinine were
measured using an autoanalyzer (Beckman Instruments, Fullerton, CA, USA).
Serum IL-6 was measured by ELISA according to assay instructions (R&D Systems,
Minneapolis, MN, USA).
Five-micrometer sections of paraffin-embedded lung tissue were stained with
hematoxylin and eosin using standard protocols. Neutrophils were counted on the basis of
morphological criteria; at least 50 high-powered fields ( 40) were counted per slide.
Frozen lung was prepared for ELISA as described previously.5 Supernatants were
analyzed for protein content using a Bio-Rad DC protein assay kit (Hercules, CA, USA).
KC and MIP-2 were determined by ELISA (R&D Systems, Minneapolis, MN, USA).
One-fourth lung was used to determine MPO activity as described previously.
Frozen lung was homogenized in radioimmunoprecipitation assay buffer with protease
inhibitor; western blotting was performed as described previously.49 Goat anti-murine
ICAM-1 polyclonal antibody (R&D Systems, Minneapolis, MN, USA; 1:2000) or rat
anti-murine VCAM-1 monoclonal antibody (R&D Systems; 1:1000) were used.
A total of 20 g anti-IL-6 antibody vs IgG control (eBioscience, San Diego, CA, USA)
was administered to wild-type mice by tail vein injection 1 h before surgery,
intraperitoneally at the time of clamp removal (ischemic AKI) or nephrectomy (bilateral
nephrectomy) and intraperitoneally 1 h following surgery (60 g total).
Experimental groups
STZ-induced diabetic rats, a model of partial type I diabetes: SD rats received a single
intraperitoneal injection of freshly prepared STZ (65 mg kg-1 body weight, dissolved in
100 mmol l-1 citric acid, pH 4.5), and confirmed 2 days later by PP blood glucose
(>250 mg dl-1).
CTR rats: Vehicle-injected SD rats after 2 to 7 days, 14 to 30 days, and 90 days served as
CTR for the 2 and 7 days STZ, the 14 and 30 days STZ, and for the 90 days STZ,
respectively.
Insulin treatment in STZ: Glc was normalized in seven animals during 12–14 days of
STZ by subcutaneous insulin implants (2U day-1; Lin Shin Canada, Ontario, Canada).
Cell Culture
Immortalized cells from the convoluted portion of mouse kidney proximal tubule
PKSV-PCT cells (PCT3 clone) were cultured in a medium A (DMEM/Ham's F12 (1:1,
v/v), 20 mM HEPES, 2 mM L-glutamine, 12.5 mM D-glucose, 60 nM sodium selenite,
5 g ml-1 transferrin, 50 nM dexamethasone, 100 U ml-1 penicillin, and 100 g ml-1
streptomycin), supplemented with 2% fetal bovine serum, 5 g ml-1 insulin, 10 ng ml-1
EGF, and 1 nM triiodothyronine at 37°C in a 95:5 air/CO2 water-saturated atmosphere.
For all experiments, cells were seeded at 0.2 106 cells/ml and after 24 h with complete
medium cells were starved for 16 h in medium A supplemented with 0.1% fetal bovine
10
serum but not insulin, EGF, or triiodothyronine. CsA was dissolved in ethanol and all the
pharmacological inhibitors were in DMSO. In all cases, controls were carried out with
cells treated with the corresponding vehicle alone. After treatments, cells were washed
twice with cold phosphate-buffered saline (PBS) and harvested with lysis buffer as in
Llorens et al
Cell viability
After treatments, PCT3 cells were harvested and washed twice with cold PBS, and the
viable cells were counted with Trypan Blue Dye (Gibco-Life Technologies, Grand Island,
NY, USA) in a Neubauer chamber. Living cells exclude the dye, whereas dead cells will
take up the blue dye. For Hoechst staining, cells seeded in six-well dishes were washed
twice with PBS and fixed for 15 min with 4% paraformaldehyde at room temperature.
Then, cells were washed twice again with PBS and stained with Hoescht (5 g ml-1 in
PBS) for 5 min.
Western blots/ Immunoblot
The protein content of cellular extracts was quantified by the Bradford assay.44
Twenty-five microgram of total cell extract protein was run on SDS-polyacrylamide gel
electrophoresis gels, transferred onto polyvinylidene difluoride membranes, and
incubated with the corresponding antibodies. The membranes were developed with the
enhanced chemiluminescence method (Pierce, Rockford, IL, USA).
Supernatants of growing or growth-arrested cells were centrifugated for 5 min at 10 000 g.
The cells were lysed as described. The proteins from supernatant and cell lysates were
concentrated using heparin sepharose. The heparin sepharose was washed four times with
phosphate-buffered saline containing protease inhibitors, dissolved in phosphate-buffered
saline/protease inhibitor and incubated with 500 g protein over night at 4°C. The
complexes were washed with phosphate-buffered saline/protease inhibitor and the
proteins were eluated with 100 l Laemmli buffer without bromophenol blue (10 min
95°C). A 30 l probe was loaded in each lane and western blot analysis was performed as
described, using a polyclonal antibody against CCN3 (K19M), which recognizes a
C-terminal 19-aminoacid peptide of human CCN3. As a positive control, a supernatant
from adrenocortical cell cultures, which are known to secrete CCN3, was used.
Cells were lysed in 0.5% (volume/volume) Triton X-100 lysis buffer and immunoblot
analysis was done as described43. Immunoprecipitation with anti-CrkL or control rabbit
antiserum was done as described44. Antibodies to the following were used:
phosphorylated Erk (910L; Cell Signaling); phosphorylated Jnk (V7932; Promega); Erk
(13-6200; Zymed); Jnk1 (sc-474), H-Ras (sc-35), C3G (sc-869), CrkL (sc-319),
RasGRP1 (sc-8430) and DGK- (sc-8722; all from Santa Cruz Biotechnologies); and
DGK- (a gift from H. Kanoh, Sapporo Medical University, Sapporo, Japan). Images
were scanned, followed by densitometry analysis with UN-SCAN-IT software (Silk
Scientific).
11
Purified splenic T cells were stimulated for various times with 5 g/ml of anti-CD3
(500A2; BD Pharmingen) and were lysed in 1% Nonidet P-40 lysis buffer (1%
(volume/volume) Nonidet-40, 150 mM NaCl and 50 mM Tris, pH 7.4) with protease
inhibitors. Proteins were resolved by SDS-PAGE and were transferred to a Trans-Blot
Nitrocellulose membrane (Bio-Rad Laboratories); membranes were probed with
antibodies specific to phosphorylated Erk (91015; Cell Signal Technology) and
phospholipase C- 1 (05-163; Upstate Biotechnology). Membranes were stripped and
were reprobed for analysis of total Erk (SC-16982; Santa Cruz Biotechnology). Activated
Ras in cell lysates was determined by glutathione S-transferase–Raf—Ras-binding
domain precipitation assay as described
Immunofluorescence microscopy.
Analysis of protein localization in 2C T cell–P815.B71 cell conjugates was done as
described29. P815.B71 cells were labeled with CMAC (7-amino-4-chloromethylcoumarin)
Cell-Tracker Blue (Molecular Probes) and were mixed with equal numbers of anergic or
in vitro–primed 2C Rag2-/- T cells. After approximately 8 min, cells were fixed, were
made permeable and were stained with anti-GRP1 and anti-talin (Santa Cruz
Biotechnologies) and with species-specific secondary antibodies conjugated to
fluorescein isothiocyanate or phycoerythrin, respectively. Samples were analyzed with a
Zeiss Axiovert 100 microscope, and 15 conjugates were typically assigned scores.
Slidebook software (Intelligent Imaging Innovations) was used for image capture and
deconvolution analysis. ImageJ 1.36b software (US National Institutes of Health) was
used for quantification of pixel intensity.
Measurement of ROS generation
The assay is based on the incorporation of 2',7'-dichlorofluorescein diacetate into the cell.
H2O2 and peroxidases are able to oxidize the cleaved DCFH to DCF, which is highly
fluorescent at 530 nm. To measure CsA-induced ROS generation, cells were washed
twice with PBS, and fresh medium containing 20 M 2',7'-dichlorofluorescein diacetate
was added to previously treated cells. After 30 min cells were washed again, tripsinized,
and resuspended with cold PBS. Fluorescence was measure by flow cytometry on a
FACScan flow cytometer.
Raf-1 activity
Raf-1 immunoprecipitation and kinase assay were performed as described previously.45
Immunoprecipitated Raf was incubated for 30 min at 30°C with 0.8 mM ATP, 10 g ml-1
GST-MEK, and 100 g ml-1 GST-ERK2. An aliquot of the supernatant was used for
ERK2 activity assays using 0.5 mg ml-1 myelin basic protein and 0.1 mM [ -32P] ATP
(400 c.p.m. pmol-1). After 15 min incubation at 30°C, 12 l of 5 Laemmli loading
buffer was added to the tubes and the mixture analyzed by SDS-polyacrylamide gel
electrophoresis. Radiolabeled bands were quantified in a PhosphoImager.
12
Semiquantitative RT-PCR.
Total RNA was isolated from freshly isolated thymocytes. Then, cDNA was prepared
with the M-MuLV reverse transcriptase and random primers according to the
manufacturer's recommendations (New England Biolabs). Semiquantitative PCR analysis
of Tcrb VDJC (where 'C' is the constant region) and Cd3e cDNA was done as described51.
[32P]dCTP (GE Healthcare Life Science) was incorporated into PCR products for
semiquantitative detection by autoradiography.
Real-time quantitative RT-PCR
Total RNA was isolated from HMC or rat mesangial cells using the Invisorb Spin
Cell-RNA Mini Kit (Invitek, Berlin, Germany) or from isolated glomeruli using the
RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA purity determination, cDNA
synthesis, and RT-PCR were performed as described.16 Primer sequences are listed in
Table 2. Glyceraldehyde-3-phosphate dehydrogenase cDNA amplification was used as an
internal standard.
Total RNA was isolated from the frozen kidneys as described by Chomczynski and
Sacchi47 and quantified by a photometer. One microgram of the resulting RNA was used
for reverse transcriptase (RT)-PCR. The cDNA was synthesized by MMLV reverse
transcriptase (Superscript-Invitrogen, Carlsbad, CA, USA). For quantification of renin
mRNA expression (sense: 5'-ATGAAGGGGGTGTCTGTGGGGTC-3', antisense:
5'-ATGCGGGGAGGGTGGGCACCTG-3'), real-time RT-PCR was performed using a
Light Cycler Instrument (Roche Diagnostics Corp., Basel, Suisse) and the QuantiTect
SYBR Green PCR kit (Qiagen, Hilden, Germany), with GAPDH (sense:
5'-TTCATTGACCTCAACTACAT-3', antisense: 5'-GAGGGGCCATCCACAGTCTT-3')
as a control. PCR was run for 30 cycles with 15 s per 95°C denaturation, 20 s/58°C
annealing and 20 s/72°C elongation. To verify the accuracy of the amplicon, a melting
curve analysis was done after amplification.Total renin mRNA content per kidney was
calculated from the yield of RNA extracted from the whole kidneys times the renin
mRNA estimate obtained from the defined amount of RNA used for RT-PCR real time
measurement. For the RT-PCR real-time measurements, a pool of RNA from adult mouse
kidneys was generated, which served as standard for all RT-PCR runs. Thus, all renin
mRNA levels for the developing kidneys were estimated relative to the levels in adult
kidneys.
In vitro anergy assay.
Wild-type, Dgka-/- and Dgkz-/- splenocytes were stained with 5 M CFSE, were
stimulated for 72 h with anti-CD3 (1 g/ml; 2C11) along with CTLA-4–Fc (5 g/ml),
were stained with allophycocyanin-conjugated anti-CD4 and were analyzed by flow
cytometry. Cell division was assessed by CFSE dilution after gating on live CD4+ cells.
Alternatively, cells were stimulated for 72 h and were pulsed with 1 Ci/well of
[3H]thymidine for the final 8 h of stimulation, and proliferation was assessed by tritium
incorporation with a scintillation counter. For restimulation analyses, cells were
13
prestimulated with anti-CD3 plus CTLA-4–Fc, then after 72 h, CD4+ cells were purified
by negative selection (with fluorescein isothiocyanate–conjugated anti-CD8, anti-B220
(RA3-6B2; BD Pharmingen), anti-DX5 and anti-CD11b (M1/70; BD Pharmingen),
followed by depletion with anti–fluorescein isothiocyanate magnetic beads) and were
allowed to 'rest' overnight at 37 °C. Live cells were then counted by Trypan blue
exclusion, and equivalent numbers of live cells were dropped onto monolayers of bone
marrow–derived macrophages coated with anti-CD3 (1 g/ml) and anti-CD28 (0.5
g/ml). After 24 h, supernatants were collected and IL-2 was quantified by ELISA
according to the manufacturer's protocol (R&D Systems).
Three-dimensional reconstruction
Serial sections of kidney specimens were fixed and stained for renin and for SMA as
described above. Digitalization of the serial slices was performed using an AxioCam
MRm camera (Zeiss, Jena, Germany) mounted on an Axiovert200M microscope (Zeiss)
with fluorescence filters for renin and SMA (TRITC: filter set 43: Cy2: filter set 38 HE;
Zeiss). After acquisition, a stack of equal-sized images was built using the graphic tool
ImageJ (Wayne Rasband, NIH, Bethesda, MD, USA). The equalized data were then
imported into the Amira 4.1 visualization software (Mercury Computer Systems Inc.,
Chelmsford, MA, USA) on a Dell Precision 690 computer system (Dell, Frankfurt,
Germany), and subsequently split into the renin and SMA channels. After this step, the
renin and SMA channels were aligned. In the segmentation step, the SMA and renin
data sets served as a scaffold and were spanned manually or automatically using
grayscale values. Matrixes, volume surfaces, and statistics were generated from these
segments.
Restimulation assay after in vivo immunization.
For analysis of T cell priming in vivo, CD4+ T cells were collected from naive, primed or
tolerized recipient mice on day 15 after immunization. Proliferative responses were
measured by culture for 72 h of CD4+ T cells (3 106 cells/ml) with irradiated (3,000 rads)
APCs (10 106 cells/ml) and OVA(323–339). The number of KJ1-26+ cells for each
group of recipient mice was determined by flow cytometry and proliferation was
normalized to the number of input KJ1-26+ cells. Supernatants were collected from plates
and cytokine concentrations were measured by ELISA.
Flow cytometry.
For analysis of surface antigen expression, mAb to CD4 (JK1.5; eBioscience) and mAb
KJ1-26 (KJ-126; Caltag) were used. For intracellular IL-2 staining, T cells were
restimulated for 24 h in vitro with OVA(323–339) in the presence of APCs as described
above. Brefeldin A (eBioscience) was added for the last 6 h of the culture. Cells were
collected and were stained with allophycocyanin-conjugated mAb to CD4 and fluorescein
isothiocyanate–conjugated mAb KJ1-26. Then, cells were fixed, were made permeable
and were stained with antibody to IL-2 (clone JES6-5H4; eBioscience) according to the
manufacturer's instructions.
14
TH1 cells transduced with adenovirus vector encoding GFP were analyzed with a
FACScan (BD Biosciences). A total of 1 104 events were acquired, and data were
analyzed with CellQuest software (BD Biosciences).
Splenic and lymph node samples depleted of thymocytes and red blood cells were stained
with fluorescence-conjugated anti-CD3 (2C11), anti-CD4 (GK15), anti-CD8 (53-6.7),
anti-CD25 (7D4) and anti-CD44 (552407; all from BD Pharmingen). A three-color
FACScan (Becton Dickinson) was used for flow cytometry, and data were analyzed with
FlowJo 4.6 (TreeStar).
A FACSCalibur (Becton Dickinson) was used for flow cytometry. Human cells from
transplanted NOD-SCID mice were assessed with phycoerythrin–cyanin 5–conjugated
anti–human CD45 and phycoerythrin-conjugated anti-CD19, anti-CD33, anti-CD36 and
anti–glycophorin A (Becton Dickinson). EGFP fluorescence was detected with channel
FL1 calibrated to the fluorescein isothiocyanate emission profile. During quadrant
analysis, only fluorescence excluding more than 99% of isotypic control events was
considered specific. Cell Quest Pro software (Becton Dickinson) and FlowJo (Tree Star)
were used for data acquisition and analysis.
Mammalian expression plasmids and transfection.
For generation of the plasmid expressing Smad3 shRNA, the following specific
oligonucleotides were used: upper,
5'-GATCCACCTGAGTGAAGATGGAGATTCAAGAGATCTCCATCTTCACTCAGG
TTTTTTTACGCGTG-3'; lower,
3'-AATTCACGCGTAAAAAAACCTGAGTGAAGATGGAGATCTCTTGAATCTCCA
TCTTCACTCAGGTG-5'. These were cloned under control of the U6 promoter into the
pSIREN-DNR-DsRed expression vector (Clontech, BD). Vector expressing shRNA
specific for luciferase served as a control. Smad3-Tm was subcloned into the
pIRES2-EGFP vector (Clontech, BD); empty vector served as a control. Purified
DO11.10 or DO11.10p27 T cells were transfected with plasmids by nucleofection with
the Amaxa nucleofection apparatus, according to the manufacturer's instructions (Mouse
T Cell Nucleofector Kit Amaxa Biosytems). Purified T cells were suspended in
nucleofector solution (3 106 cells/100 l) and were mixed with 3 g of plasmid.
Samples were transferred into cuvettes, were transfected with nucleofector program X-01
and were then immediately transferred into 12-well plates and were cultured in
nucleofector medium for 3 h. Then, cells were collected and counted and were
immediately transferred into syngeneic recipient mice (3 106 cells per mouse). At 3 h
after adoptive transfer, mice were given priming or tolerizing treatment in vivo according
to the standard protocol described above. Lymphocytes were isolated from draining
lymph nodes at day 5 of the treatment, CD4+ T cells were purified and transfection
efficiency was assessed by flow cytometry. The range of transfection efficiency was
69–75% (Supplementary Fig. 4 online). Smad3-knockdown and control-knockdown
DO11.10 cells and DO11.10 cells transfected with Smad3-Tm and vector control were
selected by cell sorting. The resulting CD4+ T cells (2 106 cells/ml) were restimulated
with OVA(323–339) (5 g/ml) in the presence of irradiated APCs in vitro.
15
Luciferase assays.
CAR IL-2–Luc TH1 clones were transduced with vectors, were stimulated for 20 h and
were resuspended in serum-free DMEM in luminometer cuvettes (BD Biosciences). An
equal volume of Bright-Glo luciferase assay reagent (Promega) was added to each sample,
followed by thorough mixing. After 2 min, samples were analyzed with a monolight 2010
Luminometer (BD Biosciences).
Analysis of cell divisions in vivo.
Purified T cells from DO11.10 and DO11.10p27 mice (10 106 cells/ml) were labeled
for 30 min at 37 °C with the intracellular fluorescent dye CFSE (5 M 5(and
6)-carboxyfluorescein succunimidyl ester; Molecular Probes). Then, cells were washed
twice with cold RPMI 1640 medium containing 10% FCS, were resuspended in PBS and
were transferred intravenously into BALB/c mice (5 106 cells per mouse). Syngeneic
hosts were left untreated (naive) or were treated with PBS followed by immunization
with OVA(323–339) (primed) or with CTLA-4–Ig plus mAb to CD40L followed by
immunization with OVA(323–339) as described above (tolerized). Then, 3 d later,
lymphocytes were isolated from the draining lymph nodes of the BALB/c hosts. The
number of cell divisions on CFSE-stained cells and the percentage of cells that had
undergone a specific number of divisions were determined as described43. Cells were also
stained with mAb KJ1-26 and CFSE analysis of KJ1-26+ T cells was done by flow
cytometry.
Adenovirus vectors.
The cDNA encoding Ras61L was provided by F. Fitch (University of Chicago, Chicago,
Illinois). The dominant negative Cbl construct was generated by RT-PCR with cDNA
from TH1 clones as a template and the following primers (upper case, restriction enzyme
sequences; underlining, Myc tag sequence):
5'-GGGGTACCatggagcagaaactcatctctgaagaggatctggccggcaacgtgaagaaga-3' (forward) and
5'-ATAGTTTAGCGGCCGCtcaatcttgaggagttggtt cacataa-3' (reverse). The cDNA
encoding DGK- was a gift from M. Topham (University of Utah, Salt Lake City, Utah)
and was used as a template to introduce an N-terminal Myc epitope tag by PCR. The
sequences of all PCR products were confirmed before subcloning. Construction of
recombinant adenovirus vectors was done with a two-cosmid system that has been
described42.
Adenoviral transduction of CAR T cells.
TH1 clones were purified from passage cultures by Ficoll-Hypaque centrifugation.
Primary CAR 2C Rag2-/- CD8+ T cells were isolated from splenocytes by negative
selection with magnetic beads and antibody 'cocktails' (Stem Cell Technologies). CAR
TH1 cells were transduced with adenovirus vectors at high cell density (1 107 cells/ml)
in DMEM containing 2% (volume/volume) FCS and were incubated for 1 h at 37 °C,
16
followed by an overnight 'rest' at 37 °C in DMEM containing 5% (volume/volume) FCS
at low cell density (4 105 cells/ml).
Lentivirus production and infection protocols.
A third-generation lentiviral vector encoding EGFP expressed from the human
phosphoglycerate kinase promoter was used as described29, 33. Cell populations were
incubated overnight (about 16 h) in X-VIVO-10 medium (BioWhittaker) supplemented
with 1% BSA (Stem Cell Technologies) and L-glutamine (Invitrogen) with viral
supernatant (multiplicity of infection of 130–180). Viral concentrations of 1.0 108 to 1.8
108 viral particles/ml, 2.0 107 to 4.4 107 viral particles/ml and 0.9 108 to 1.6 108
viral particles/ml and cell concentrations of 0.7 106 to 1.1 106 cells/ml, 1.0 105 to 2.5
105 cells/ml and 0.7 106 to 1.4 106 cells/ml for CD34+CD38lo, CD34+CD38- and Lin-
cord blood, respectively, were maintained. The efficiency of gene transfer was estimated
by progenitor cell assay as described33.
Apoptosis induction.
Spontaneous apoptosis of PMNs was detected after 22 h of incubation in culture media.
In some experiments, zVAD-fmk (10-50 M), TNF (40 ng/ml), resolvin E1–methyl ester,
aspirin-triggered lipoxin A4 analog, PD1–methyl ester (10 nM) or TGF- (10 ng/ml) was
added. Vehicle treatment was 0.05% (volume/volume) ethanol. Peripheral blood T cells
were activated by incubation for 3 d in 24-well plates coated with anti-CD3 (5 g/ml;
R&D Systems). Jurkat cells or activated peripheral blood T cells were incubated for 4–48
h with staurosporine (1–2 M) or Fas ligand (0.05–5 ng/ml), after which cells were
collected and used for flow cytometry or binding assays. In some experiments,
zVAD-fmk (10–50 M; R&D Systems) was added to cells 20 min before the addition of
apoptosis-indu
Mice strains and genotyping.
The 129/Sv Rhoh-/- mice were generated by Targeting Laboratory. The entire coding
region of mouse Rhoh is in its third exon; the targeting vector was designed to replace the
third exon of Rhoh with a neomycin-resistance cassette. The genotypes of Rhoh
gene-targeted embryonic stem cells and transgenic mice were determined by Southern
blot analysis of DNA digested with SpeI using a 5' Rhoh genomic DNA probe or by PCR
analysis with primers. The 129/Sv Rhoh-/- mice were crossed with wild-type or p14 TCR
(V 2V 8) transgenic mice on a C57BL/6J background to generate Rhoh-/- or
p14tg/+Rhoh-/- compound mice. Mice used were littermates derived from backcross
generations with an N of more than 2. The 129S6/SvEvTac-Rag2-/- mice were purchased
from Taconic Animal Models. All animal experiments were approved by the Institutional
Animal Care and Use Committee of the Cincinnati Children's Hospital Research
Foundation (Cincinnati, Ohio).
Antibodies and GST fusion proteins.
17
Fluorescence-conjugated monoclonal antibodies to the following mouse antigens were
used for flow cytometry: CD4 (RM4-5), CD8 (53-6.7), CD25 (7D4), CD44 (IM7), TCR
-chain (H57-597), TCR (GL3), TCR V 8, TCR V 5 (MR9-4), CD69 (H1.2F3), CD5
(53-7.3), Gr-1 (RB6-8C5), Mac-1 (M1-70), NK1.1 (PK136), Thy1.2 (53-2.1),
CD45R–B220 (RA3-6B2), IgM (R6-60.2), BrdU (3D4) and Ter119 (Ly-76; all from
Pharmingen). For immunoblot analyses, antibodies to the following were used: RhoH9
(B4998), Zap70 phosphorylated at Y319 (17a), phosphorylated tyrosine (4G10) and Lat
(45; Pharmingen); hemagglutinin (3F10; Roche); -actin (AC-15; Sigma); CD3
(6B10.2; Santa Cruz Biotechnology); and Lat phosphorylated at Y191 (3584), Zap70
(99F2), phosphorylated p42-p44 (Thr202-Tyr204; 197G2) and p42-p44 (9102; Cell
Signaling Technology). Primary antibodies were detected with the secondary antibodies
horseradish peroxidase–conjugated goat anti-mouse (7076) or goat anti-rabbit (7074; both
Cell Signaling Technology), or donkey anti-rat (sc-2956; Santa Cruz Biotechnology)
using enhanced chemiluminescence detection (Cell Signaling Technology). GST fusion
proteins were expressed in Escherichia coli BL21 (DE3) cells and were purified
according to the manufacturer's recommendations (GE Healthcare Life Science). Purified
GST fusion protein lysates were incubated for 1 h at 4 °C with glutathione–Sepharose 4B
beads. Bead-bound GST fusion proteins were separated by SDS-PAGE and were
quantified by Coomassie blue staining.
GST precipitation assay.
Jurkat cells were lysed in GST lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10
mM MgCl2, 1% Nonidet-P40 and Complete Protease Inhibitors). Cell lysates were loaded
onto columns of bead-bound GST fusion proteins. After columns were washed with GST
lysis buffer containing 150 mM and 200 mM NaCl, bound proteins were eluted with GST
lysis buffer containing 400 mM NaCl and SDS sample buffer, sequentially. Eluted
proteins were detected by SDS-PAGE and Coomassie blue staining. Protein bands were
identified with a Bruker Biflex III MALDI-TOF mass spectrometer (SpectroREADER;
Sequenom) and Protein Mass Fingerprinting Mascot search (Matrix Science).
Subcellular fractionation.
Cells were lysed by brief sonication on ice in a buffer of 250 mM sucrose, 20 mM Tris,
pH 7.8, 10 mM MgCl2, 1 mM EDTA, 1 mM Na3VO4, 10 mM NaF and Complete
Protease Inhibitors. Lysates were centrifuged to remove nuclei and debris (900g for 5 min
at 4 °C). The P100 and S100 fractions were separated by centrifugation for 30 min at
100,000g. Membrane fractions were made soluble with MLB (Upstate) plus protease and
phosphatase inhibitors. After centrifugation for additional 30 min at 100,000g, the
detergent-insoluble cytoskeleton-containing fraction was resolved by 0.5% SDS-PAGE.
Assessment of Intracellular Calcium Concentration

评价一下你浏览此帖子的感受

分享到： QQ空间新浪微博腾讯微博人人网网易微博

关键词: 医学SCI 论文经典句子

回复引用

举报顶端

上一主题下一主题

考博论坛 » 医学考博论坛

http://www.freekaobo.com
访问内容超出本站范围，不能确定是否安全
继续访问	取消访问

快速回复
	限 100 字节进入高级模式加粗字体颜色背景颜色插入链接图片验证问题: 5+2=? 正确答案:7 按"Ctrl+Enter"直接提交	上一个下一个